SubtiBank SubtiBank
yneR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneR

unknown
locus
BSU_18060
pI
3.67
mw
10.69 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,931,545 1,931,832

    The protein

    Protein family

  • HesB/IscA family (with [protein|94A3B5EF4ADCFA57A204B584B6D305A62E3E15AE|SufA], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ADDEE0B251CBE61892482F15F91543242EDBF2A0|plsY]-[gene|5959516D55C9EDBFC46F28C8248D374832895740|yneR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18060 ([gene|5959516D55C9EDBFC46F28C8248D374832895740|yneR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAACACCCCTTTG, downstream forward: _UP4_TAAAAAAGAACGCACTTCAT
  • BKK18060 ([gene|5959516D55C9EDBFC46F28C8248D374832895740|yneR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAACACCCCTTTG, downstream forward: _UP4_TAAAAAAGAACGCACTTCAT