SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


galactose-1-phosphate uridylyltransferase
58.44 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
galactose utilization
galactose-1-phosphate uridylyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactose]
  • Gene

    3,919,093 3,920,634

    The protein

    Catalyzed reaction/ biological activity

  • α-D-galactose 1-phosphate + UDP-α-D-glucose --> α-D-glucose 1-phosphate + UDP-α-D-galactose (according to UniProt)
  • Protein family

  • galactose-1-phosphate uridylyltransferase type 2 family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab



  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials


  • BKE38190 ([gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGATGTTCAATAATACTCA, downstream forward: _UP4_TAGGGTTGAGGCTTTTTCGA
  • BKK38190 ([gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGATGTTCAATAATACTCA, downstream forward: _UP4_TAGGGTTGAGGCTTTTTCGA
  • References

  • 9353933,10666464,22383849,22893383