SubtiBank SubtiBank


citrate synthase
41.57 kDa
protein length
372 aa Sequence Blast
gene length
1119 bp Sequence Blast
TCA cycle
citrate synthase II

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,981,151 2,982,269

    Phenotypes of a mutant

  • glutamate auxotrophy and a defect in sporulation [Pubmed|8045898]
  • The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + H2O + oxaloacetate --> citrate + CoA + H+ (according to UniProt)
  • Protein family

  • citrate synthase family (with [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|MmgD] and [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|CitA], according to UniProt)
  • Paralogous protein(s)

  • [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|CitA], [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|MmgD]
  • Modification

  • phosphorylation on Ser-284 [Pubmed|17218307]
  • Effectors of protein activity

  • Inhibited by acetyl-CoA, 2-oxoglutarate and NADH [Pubmed|4211224] [ FEBS Letters]
  • Inhibited by citrate and CoA (competitively against acetyl-CoA and non-competitively against oxaloacetate) [Pubmed|4211224]
  • Inhibited by ATP competitively in ''B. subtilis'' strain 168 and HS 1A17 [Pubmed|4980242] [Pubmed|4211224]
  • In ''B. subtilis'' strain HS 2A2, ATP inhibits a non-competitive fashion [Pubmed|4211224]
  • Activated by AMP [Pubmed|4211224]
  • Structure

  • [PDB|2C6X]
  • [PDB|A discussion of citrate synthase structure]
  • [SW|Localization]

  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • Additional information

  • extensive information on the structure and enzymatic properties of CitZ can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA destabilization, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • ''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12100558]
  • view in new tab

    Biological materials


  • GP678 (erm), GP797 (spec) available in [SW|Jörg Stülke]'s lab
  • 1A999 (''citZ''::''spec''), [Pubmed| ], available at [ BGSC]
  • GP790 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [SW|Jörg Stülke]'s lab
  • GP797 (''citZ''::''spec''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [SW|Jörg Stülke]'s lab
  • GP1281 (''citZ''::''erm''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [SW|Jörg Stülke]'s lab
  • GP2331 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [SW|Jörg Stülke]'s lab
  • GP2333 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE29140 ([gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT, downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
  • BKK29140 ([gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT, downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
  • Expression vectors

  • pGP1120 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • pGP1776 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • pGP1761 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP2515 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP2261 (integration into [gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA], expression under the control of the xylose-inducible PxylA promoter in ''B. subtilis'', in [SW|pGP888]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 3013232
  • Original publications

  • 10348849,8045899,22900538,10656796,12850135,17218307,12100558,9642180,8045898,8655569,4211224,4980242,20525796,24825009,20933603,23354745,24571712,29546354