SubtiBank SubtiBank
yrzH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzH

unknown
locus
BSU_27800
pI
5.26
mw
5.11 kDa
protein length
gene length
132 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,841,169 2,841,300

    Expression and Regulation

    Operons

    genes
    [gene|58CC9C8031955B3F2BB1495E4DAB0B2418BF2220|yrzH]-[gene|0958E85520014A22327D5972D927D53A33C81E36|yrzT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE27800 ([gene|58CC9C8031955B3F2BB1495E4DAB0B2418BF2220|yrzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTGGGCGGCTGTCCG, downstream forward: _UP4_CAGGCGTCAGTGAGGTGATG
  • BKK27800 ([gene|58CC9C8031955B3F2BB1495E4DAB0B2418BF2220|yrzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTGGGCGGCTGTCCG, downstream forward: _UP4_CAGGCGTCAGTGAGGTGATG