SubtiBank SubtiBank
aroB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aroB

3-dehydroquinate synthase
locus
BSU22700
pI
6.94
mw
40.66 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
3-dehydroquinate synthase
essential
no
ec
4.2.3.4
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,378,012 2,379,100

    The protein

    Catalyzed reaction/ biological activity

  • 3-deoxy-D-arabino-hept-2-ulosonate 7-phosphate = 3-dehydroquinate + phosphate (according to Swiss-Prot)
  • Protein family

  • [SW|sugar phosphate cyclases superfamily] (according to UniProt)
  • Structure

  • [PDB|3CLH] (from ''Helicobacter pylori'', 36% identity) [Pubmed|18503755]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]-[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|21815947]
    view in new tab

    Biological materials

    Mutant

  • 1A613 ( ''aroB''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A613&Search=1A613 BGSC]
  • BKE22700 ([gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22700 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_AGTTTGAACATGCAGTGTCT, downstream forward: _UP4_AAATGGCGATTGGAGGAGAC
  • BKK22700 ([gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTTGAACATGCAGTGTCT, downstream forward: _UP4_AAATGGCGATTGGAGGAGAC
  • References

    Reviews

  • 12966138
  • Original publications

  • 4200844,18503755,21815947,28516784