SubtiBank SubtiBank
ybaR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybaR

fumarate transporter
locus
BSU_01580
pI
7.90
mw
51.01 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
function
uptake of fumarate
product
fumarate:proton symporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    177,083 178,519

    The protein

    Protein family

  • SLC26A/SulP transporter (TC 2.A.53) family (with [protein|7028580E25DD6C1D49A14F29DDCC02012F94FED7|YvdB], according to UniProt)
  • [SW|Domains]

  • [SW|STAS domain] (aa 389-478) (according to UniProt)
  • Structure

  • [PDB|5DA0] (from ''Deinococcus radiodurans'', 63% identity) [Pubmed|26367249]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B948 (ybaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1947 NBRP B. subtilis, Japan]
  • BKE01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT, downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
  • BKK01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT, downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
  • References

  • 26367249