SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sulfate transport in via proton symport
36.68 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
sulfate uptake
sulfate transport in via proton symport

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,631,095 1,632,159

    The protein

    Protein family

  • inorganic phosphate transporter (PiT) (TC 2.A.20) family (with [protein|BBFA6A5EE16CE6203AF89573F87678395277C9E8|Pit], according to UniProt)
  • [SW|Localization]

  • cell membrane
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B365 (ylnA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC, downstream forward: _UP4_TGATCATTAATCTGAGTAAT
  • BKK15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC, downstream forward: _UP4_TGATCATTAATCTGAGTAAT
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16267287,18039762,12107147