SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


biotin synthase
36.77 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
biosynthesis of biotin
biotin synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • The protein

    Catalyzed reaction/ biological activity

  • [sulfur carrier]-SH + dethiobiotin + 2 reduced [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> 2 5'-deoxyadenosine + [sulfur carrier]-H + biotin + 2 L-methionine + 2 oxidized [2Fe-2S]-[ferredoxin] (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1R30] (from ''E. coli'', 36% identity) [Pubmed|14704425]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • BKK30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • References

  • 14704425,8763940,8892842