SubtiBank SubtiBank
abh
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

abh

transcriptional regulator of transition state genes
locus
BSU_14480
pI
5.75
mw
10.12 kDa
protein length
gene length
279 bp Sequence Blast
function
regulation of gene expression during the transition from growth to stationary phase
product
transcriptional regulator
essential
no
synonyms
ylxT,yzaA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,517,865 1,518,143

    Phenotypes of a mutant

  • inactivation of ''[gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]'' results in sensitivity against beta-lactam antibiotics that can be restored by induction of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' expression or by inactivation of the genes encoding major autolysins (''[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC], [gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'') [Pubmed|22211522]
  • The protein

    Paralogous protein(s)

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]
  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]:
  • [SW|Domains]

  • [SW|SpoVT-AbrB domain] (aa 5-50) (according to UniProt)
  • Structure

  • [PDB|2FY9] (N-terminal DNA recognition domain)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000212 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]
    description
    [Pubmed|8002614]

    sigma factors

  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|19465659], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • view in new tab

    Biological materials

    Mutant

  • BKE14480 ([gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCTTCTTCCTT, downstream forward: _UP4_TAAAATTATGCTAAAAAAGG
  • BKK14480 ([gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCTTCTTCCTT, downstream forward: _UP4_TAAAATTATGCTAAAAAAGG
  • labs

  • [SW|Mark Strauch], Baltimore, USA [http://lifesciences.umaryland.edu/Pages/faculty_profile.aspx?ID=212 homepage]
  • References

    The [SW|Abh regulon]

  • 20817675
  • Other original publications

  • 9636707,19465659,16306698,16702211,17720793,19767430,8002614,22211522,20844865,21926231