SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


potential D protein for the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|search|YndF ]germinant receptor of unknown specificity
6.83 kDa
protein length
gene length
189 bp Sequence Blast
potential D protein for the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|search|YndF ]germinant receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • Gene

    1,907,013 1,907,201

    Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    Biological materials


  • BKE17740 ([gene|5847A7629C78CF770525CF79120CDD55D9622793|ynzB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCTCCTGTTTT, downstream forward: _UP4_TAGTTTTCCCAGACTGCTAA
  • BKK17740 ([gene|5847A7629C78CF770525CF79120CDD55D9622793|ynzB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCTCCTGTTTT, downstream forward: _UP4_TAGTTTTCCCAGACTGCTAA
  • References

  • 23625846