SubtiBank SubtiBank
melR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

melR

transcriptional regulator of the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon
locus
BSU_30260
pI
6.45
mw
38.24 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
regulation of melibiose utilization
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
msmR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,096,782 3,097,816

    The protein

    Catalyzed reaction/ biological activity

  • represses the the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon in the absence of melibiose or raffinose [pubmed|31138628]
  • Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 2-58) (according to UniProt)
  • Structure

  • [PDB|1VPW] (E. coli [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR], 29% identity) [pubmed|9628480]
  • Expression and Regulation

    Operons

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A802 (msmR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/802 NBRP B. subtilis, Japan]
  • BKE30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA
  • BKK30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA
  • References

  • 22383849,22900538,9628480,31138628