SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to exodeoxyribonuclease VII (small subunit)
6.14 kDa
protein length
gene length
255 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    2,526,669 2,526,923

    The protein

    Catalyzed reaction/ biological activity

  • Exonucleolytic cleavage in either 5'- to 3'- or 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
  • Protein family

  • xseB family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot), Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Biological materials


  • BKE24290 ([gene|5815A073CDF3856E9A0B52FB35F74DA16B8D1F53|yqiC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCATTTTTTTTCACGT, downstream forward: _UP4_TTCAGTGTTCAGGAGGAAGA
  • BKK24290 ([gene|5815A073CDF3856E9A0B52FB35F74DA16B8D1F53|yqiC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCATTTTTTTTCACGT, downstream forward: _UP4_TTCAGTGTTCAGGAGGAAGA
  • References

  • 16479537