SubtiBank SubtiBank
lutB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lutB

lactate catabolic enzyme
locus
BSU_34040
pI
5.85
mw
53.31 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
lactate utilization
product
lactate oxidase
essential
no
synonyms
yvfW

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,493,519 3,494,958

    Phenotypes of a mutant

  • no growth with lactate as the single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of lactate to pyruvate [Pubmed|19201793]
  • Protein family

  • LutB/YkgF family (single member, according to UniProt)
  • [SW|Domains]

  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 304-334, aa 353-382) (according to UniProt)
  • Modification

  • phosphorylated on Arg-33 [Pubmed|22517742]
  • [SW|Cofactors]

  • FeS cluster
  • Expression and Regulation

    Operons

    genes
    [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]
    description
    [Pubmed|19201793]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19201793], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • induction by lactate [Pubmed|19201793]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|22427629,18697947]
  • [protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|FbpB]: translation inhibition, acts as RNA chaperone, increases interaction between [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA] and [protein|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|LutA]-[protein|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|LutB]-[protein|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|LutC] RNAs
  • Biological materials

    Mutant

  • MGNA-A498 (yvfW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/498 NBRP B. subtilis, Japan]
  • BKE34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • BKK34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

  • 22427629,18697947,16430695,22389480,19201793,19201793,22517742