SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


lactate catabolic enzyme
53.31 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
lactate utilization
lactate oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,493,519 3,494,958

    Phenotypes of a mutant

  • no growth with lactate as the single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of lactate to pyruvate [Pubmed|19201793]
  • Modification

  • phosphorylated on Arg-33 [Pubmed|22517742]
  • [SW|Cofactors]

  • FeS cluster
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19201793], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • induction by lactate [Pubmed|19201793]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|22427629,18697947]
  • [protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|FbpB]: translation inhibition, acts as RNA chaperone, increases interaction between [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA] and [protein|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|LutA]-[protein|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|LutB]-[protein|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|LutC] RNAs
  • Biological materials


  • MGNA-A498 (yvfW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • BKK34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References

  • 22427629,18697947,16430695,22389480,19201793,19201793,22517742