SubtiBank SubtiBank
ureA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ureA

urease (gamma subunit)
locus
BSU_36660
pI
4.98
mw
11.32 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
utilization of urea as alternative nitrogen source
product
urease (gamma subunit)
essential
no
ec
3.5.1.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.2|Utilization of urea]
  • Gene

    Coordinates
    3,768,791 3,769,108

    The protein

    Catalyzed reaction/ biological activity

  • 2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
  • Protein family

  • urease gamma subunit family (single member, according to UniProt)
  • Structure

  • [PDB|2FVH] (from ''Mycobacterium tuberculosis'', 57% identity, 62% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
    description
    [Pubmed|9287005]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9287005], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9287005], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, [Pubmed|9287005], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9287005], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12374841], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|9287005,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
  • view in new tab

    Biological materials

    Mutant

  • BKE36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT, downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
  • BKK36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT, downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
  • References

    Reviews

  • 23539618,19363030
  • Original publications

  • 12374841,18083814,12618455,9287005,9287005,12374841,9287005,1670935,16199586,25755103