SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


thiamine [SW|ECF transporter] (binding protein)
21.88 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
thiamine uptake
thiamine [SW|ECF transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW|Class I ECF transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,391,040 1,391,642

    The protein


  • [PDB|1SBR] (complex with thiamine), [PDB|1S99]
  • [SW|Localization]

  • membrane associated (via [protein|9AF27E4CE34B5C4036840A27D93B13213E3324DD|ThiV]-[protein|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|ThiX]) [Pubmed|16291685]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([protein|search|Thi-box]) [Pubmed|12376536]
  • view in new tab

    Biological materials


  • MGNA-A757 (ykoF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKK13240 ([gene|57A953B5D71F3FD8269EAF2366B8E2C7A8C79483|thiU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCCGACCTCCTGTT, downstream forward: _UP4_AGAAAAAACAGAAAGCAGGG
  • References

  • 16291685,12376536,15451668