SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


lipid carrier sugar transferase, disrupted pseudogene in B. subtilis 168
0.00 kDa
protein length
162 aa Sequence Blast
gene length
486 bp Sequence Blast
biosynthesis of teichuronic acid
lipid carrier sugar transferase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of teichuronic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,658,407 → 3,658,892

    The protein

    Catalyzed reaction/ biological activity

  • di-trans,octa-cis-undecaprenyl phosphate + UDP-N-acetyl-α-D-galactosamine --> N-acetyl-α-D-galactosaminyl-1-diphospho-di-trans,octa-cis-undecaprenol + UMP (according to UniProt)
  • Protein family

  • Bacterial sugar transferase family (with [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL], according to UniProt)
  • Paralogous protein(s)

  • [protein|D67665412B78B56752B460219445E4BEF52C3A1A|EpsL]
  • Structure

  • [PDB|5W7L] (from Campylobacter concisus, 41% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials


  • BKE35610 (Δ[gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACACACACCTCACGA, downstream forward: _UP4_GAGATTCCAGGCTTTACACA
  • BKK35610 (Δ[gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACACACACCTCACGA, downstream forward: _UP4_GAGATTCCAGGCTTTACACA
  • References

  • 9683503,9611818,10627039,10048024