SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


homocysteine methyltransferase
34.58 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
biosynthesis of methionine
homocysteine methyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    261,656 262,603

    The protein

    Catalyzed reaction/ biological activity

  • S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
  • [SW|Cofactors]

  • Zn2+ (according to UniProt)
  • Structure

  • [PDB|5DML] (from ''Escherichia coli'', 52% identity) [pubmed|26564203]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B941 (ybgG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • BKK02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • References

  • 11267663,15995196,9882684,11898408,26564203