SubtiBank SubtiBank
mdxE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mdxE

maltodextrin [SW|ABC transporter], binding protein
locus
BSU34610
pI
4.91
mw
45.44 kDa
protein length
417 aa Sequence Blast
gene length
1254 bp Sequence Blast
function
maltodextrin utilization
product
maltodextrin [SW|ABC transporter], binding protein
essential
no
synonyms
yvdG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,554,553 3,555,806

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D4A5A878F87EBC14C02824233155CEBACEB41343|GanS]
  • Structure

  • [PDB|5TU0] (from Listeria monocytogenes, 67% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B627 (yvdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1626 NBRP B. subtilis, Japan]
  • BKE34610 ([gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTTCCTCCTTCTA, downstream forward: _UP4_TAAAACGGCGGGATAGCGTC
  • BKK34610 ([gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTTCCTCCTTCTA, downstream forward: _UP4_TAAAACGGCGGGATAGCGTC
  • References

  • 10092453,16707683