SubtiBank SubtiBank
spoIIIAD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIIAD

component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] type III secretion system residing in the forespore membrane, required for [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activation
locus
BSU_24400
pI
4.73
mw
14.27 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
product
component of a type III secretion system
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,535,544 2,535,945

    The protein

    [SW|Localization]

  • membrane protein [Pubmed|18485064]
  • Expression and Regulation

    Operons

    genes
    [gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]-[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
    description
    [Pubmed|1766372]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]
  • view in new tab

    genes
    [gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
    description
    [Pubmed|18485064]

    regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE24400 ([gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACAATGTCAATCTGCAAGC, downstream forward: _UP4_TCATAACCGAAAGGAGGCGG
  • BKK24400 ([gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACAATGTCAATCTGCAAGC, downstream forward: _UP4_TCATAACCGAAAGGAGGCGG
  • References

    Reviews

  • 31350897
  • Original Publications

  • 1766372,18485064,19609349,27766092