SubtiBank SubtiBank
yvsH [2018-09-13 18:40:35]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvsH [2018-09-13 18:40:35]

putative lysine transporter
50.09 kDa
protein length
469 aa Sequence Blast
gene length
1407 bp Sequence Blast
uptake of lysine
putative lysine transporter

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,419,656 → 3,421,065

    The protein


  • [PDB|3LRB] (from ''E. coli'', 32% identity) [Pubmed|19478139]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|L-box|L-box]: transcription termination/antitermination, via a riboswitch, in [regulon|L-box|L-box]
  • view in new tab

    Biological materials


  • MGNA-B067 (yvsH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33330 (Δ[gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • BKK33330 (Δ[gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • References

  • 18763711,14627808,19478139