SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative lysine transporter
50.09 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
uptake of lysine
putative lysine transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,419,656 3,421,065

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Structure

  • [PDB|3LRB] (from ''E. coli'', 32% identity) [Pubmed|19478139]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|L-box|L-box]: transcription termination/antitermination, via a riboswitch, in [regulon|L-box|L-box]
  • view in new tab

    Biological materials


  • MGNA-B067 (yvsH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • BKK33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • References

  • 18763711,14627808,19478139