SubtiBank SubtiBank
yvsH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvsH

putative lysine transporter
locus
BSU_33330
pI
9.74
mw
50.09 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
function
uptake of lysine
product
putative lysine transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,419,656 3,421,065

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Structure

  • [PDB|3LRB] (from ''E. coli'', 32% identity) [Pubmed|19478139]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|5762418690734FB959506B7317208CCA1A340720|yvsH]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|L-box|L-box]: transcription termination/antitermination, via a riboswitch, in [regulon|L-box|L-box]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B067 (yvsH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1066 NBRP B. subtilis, Japan]
  • BKE33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • BKK33330 ([gene|5762418690734FB959506B7317208CCA1A340720|yvsH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAGTACCTCCATGAT, downstream forward: _UP4_TAATGAAAAGACACCTGATT
  • References

  • 18763711,14627808,19478139