SubtiBank SubtiBank
manP
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

manP

trigger enzyme: mannose-specific phosphotransferase system, EIIBCA of the PTS
locus
BSU12010
pI
6.72
mw
61.81 kDa
protein length
589 aa Sequence Blast
gene length
1767 bp Sequence Blast
function
mannose uptake and phosphorylation, control of ManR activity
product
trigger enzyme: mannose-specific phosphotransferase system, EIIBCA
essential
no
synonyms
yjdD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.9|Utilization of mannose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,272,725 → 1,274,677

    The protein

    Catalyzed reaction/ biological activity

  • transport and concomitant phosphorylation of mannose
  • Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, fructose/ mannitol permease (Fru) family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|FruA]
  • Modification

  • phosphorylation on Ser-365 [Pubmed|17218307]
  • Structure

  • [PDB|2R48] (IIB domain)
  • [SW|Localization]

  • membrane
  • Expression and Regulation

    Operons

    genes
    [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
    description
    [Pubmed|20139185]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [protein|575CEC5C5C0458DC86A74F24654AC6990CB1E732|ManP]-[protein|E26C70893C5D677C816C814558CC42F90B920087|ManA]-[protein|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|YjdF] mRNA between [protein|E26C70893C5D677C816C814558CC42F90B920087|ManA] and [protein|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|YjdF], in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A270 (yjdD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/270 NBRP B. subtilis, Japan]
  • BKE12010 (Δ[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
  • BKK12010 (Δ[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
  • References

  • 10627040,17218307,10627040,20139185,23033921,23551403,26238998