SubtiBank SubtiBank
feuB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

feuB

[SW|ABC transporter ]for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)
locus
BSU01620
pI
9.54
mw
35.74 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
[SW|acquisition of iron]
product
[SW|ABC transporter ]for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    181,347 182,351

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD], [protein|3E1C925C31C00803982C8EB1C6B025C22DB4A828|FhuB]
  • Structure

  • [PDB|4G1U] (heme transporter from Yersinia pestis, 33% identity) [pubmed|23142986]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr]: activation, in the presence of the co-activators bacillibactin or enterobactin [Pubmed|17725565], in [regulon|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Other regulations

  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: translation control,
  • Biological materials

    Mutant

  • BKE01620 ([gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACATACAAAAACCTACTC, downstream forward: _UP4_ATTAAACGAAAAGGAGGGGA
  • BKK01620 ([gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACATACAAAAACCTACTC, downstream forward: _UP4_ATTAAACGAAAAGGAGGGGA
  • References

  • 19746494,16672620,10092453,16889643,17725565,12354229,10468622,29133393,23142986