SubtiBank SubtiBank
argH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

argH

argininosuccinate lyase
locus
BSU29440
pI
4.86
mw
51.76 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
biosynthesis of arginine
product
argininosuccinate lyase
essential
no
ec
4.3.2.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • Gene

    Coordinates
    3,011,751 3,013,136

    The protein

    Catalyzed reaction/ biological activity

  • 2-(N(omega)-L-arginino)succinate = fumarate + L-arginine (according to Swiss-Prot)
  • Protein family

  • Argininosuccinate lyase subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|1TJ7] (from ''Escherichia coli'', 47% identity, 64% similarity) [Pubmed|15502303]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC])
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • GP1688 Δ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH])::''aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE29440 ([gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCGGCCTCCCCAAAGCT, downstream forward: _UP4_TAAAATTTCCTTCATAAAAT
  • BKK29440 ([gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCGGCCTCCCCAAAGCT, downstream forward: _UP4_TAAAATTTCCTTCATAAAAT
  • References

  • 12107147,21821766,22383849