SubtiBank SubtiBank
nprB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nprB

extracellular neutral protease B
locus
BSU_11100
pI
5.32
mw
59.17 kDa
protein length
538 aa Sequence Blast
gene length
1617 bp Sequence Blast
function
degradation of proteins
product
extracellular neutral protease B
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.2|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,186,037 1,187,653

    The protein

    Protein family

  • peptidase M4 family (with [protein|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|NprE], according to UniProt)
  • Paralogous protein(s)

  • [protein|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|NprE]
  • Structure

  • [PDB|5A3Y] (thermolysin, 44% identity) [pubmed|26527148]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE11100 ([gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACACCACATCCTTCCT, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • BKK11100 ([gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACACCACATCCTTCCT, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • References

    Reviews

  • 20735481
  • Original publications

  • 24115457,26527148