SubtiBank SubtiBank
ndh
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ndh

NADH dehydrogenase (Menaquinone 7 & no proton)
locus
BSU_12290
pI
6.29
mw
41.79 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
respiration
product
NADH dehydrogenase (Menaquinone 7 & no proton)
essential
no
synonyms
yjlD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,299,074 1,300,252

    Phenotypes of a mutant

  • inactivation of ''ndh'' facilitates growth without a cell wall (due to reduction of oxidative stress) [Pubmed|26051891]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • NADH dehydrogenase family (with [protein|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|YutJ] and [protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|YumB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|YumB]
  • [SW|Cofactors]

  • FAD [pubmed|31133996]
  • Structure

  • [PDB|4NWZ] (from ''C. thermarum'', 42% identity) [Pubmed|24444429]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
    description
    [Pubmed|17015645]

    regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|17015645], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induced at high NADH+ levels ([protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]) [Pubmed|17015645]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    genes
    [gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]-[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A358 (yjlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/358 NBRP B. subtilis, Japan]
  • BKE12290 ([gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG
  • BKK12290 ([gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG
  • References

  • 17015645,20933603,11948165,18763711,15378759,26051891,24444429,28439033,10913079,28189581,31133996