SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


modulation of CheA activity in response to attractants
34.48 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
control of CheA activity
CheA modulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Coupling proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    1,473,605 1,474,516

    Phenotypes of a mutant

  • ''[gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV] [gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]'' double mutants exhibit complete loss of chemotaxis [Pubmed|21098025]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Paralogous protein(s)

  • [protein|887D84520DF3D5F22DED525C1C17130EDE60DC36|CheW]:
  • [SW|Domains]

  • N-terminal [protein|887D84520DF3D5F22DED525C1C17130EDE60DC36|CheW]-like domain, C-terminal two-component receiver domain [Pubmed|11553614]
  • [SW|Response regulatory domain] (aa 176-302) (according to UniProt)
  • CheW-like domain (aa 16-154) (according to UniProt)
  • Modification

  • the C-terminal two-component receiver domain is phosphorylated on a Asp residue by [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|11553614]
  • [SW|Localization]

  • forms lateral clusters (phosphorylated form), but in the presence of high asparagine concentration (non-phosphorylated form) there is a reversible re-localization to the poles of the cell [Pubmed|21098025]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8169223], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, CheV is present with 7,500 /- 2,000 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials


  • DS70 (''cheV''::''mls'' in NCIB3610) [Pubmed|12864845]
  • BKE14010 ([gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
  • BKK14010 ([gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
  • References


  • 18774298
  • Original publications

  • 12864845,26122431,8169224,8169223,11553614,14731274,21098025,21515776,26844549