SubtiBank SubtiBank
rocG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rocG

trigger enzyme, glutamate dehydrogenase and effector protein for [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]
locus
BSU_37790
pI
6.28
mw
46.48 kDa
protein length
424 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
arginine utilization, controls the activity of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]
product
glutamate dehydrogenase
essential
no
ec
1.4.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.2|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • Gene

    Coordinates
    3,880,740 3,882,014

    Phenotypes of a mutant

  • Poor growth on complex media such as SP (sporulation medium). No growth in minimal media with arginine as the only carbon source. Rapid accumulation of suppressor mutants ([gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|''gudB1'']]])
  • sensitive to -lactam antibiotics such as cefuroxime and to fosfomycin (suppressed by activation of ''[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'') due to the downregulation of the [SW|SigW regulon] [Pubmed|22178969]
  • transcription profile of a ''[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34383&submit.x=22&submit.y=9 GEO] [Pubmed|22178969]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamate + NAD+ --> 2-oxoglutarate + H+ + NADH + NH4+ (according to UniProt)
  • controls the activity of the [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] transcription activator [Pubmed|17608797]
  • Protein family

  • Glu/Leu/Phe/Val dehydrogenases family (with [protein|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|Bcd] and [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|GudB], according to UniProt)
  • Paralogous protein(s)

  • [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|GudB]
  • Kinetic information

  • KM [glutamate] = 2.9 mM, KM [ammonium] = 18 mM [Pubmed|20630473]
  • [SW|Cofactors]

  • NAD+/NADH + H+
  • Structure

  • [PDB|3K92] (super-repressor mutant that is capable of constitutive inactivation of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC], E93K mutation) [Pubmed|20630473]
  • Expression and Regulation

    Operons

    genes
    [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
    description
    [Pubmed|10468601]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10468601], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|10468601,12634342], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|17183217], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|15150224], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • Activation by [protein|search|RocR] requires binding of [protein|search|RocR] to a downstream element [PubMed|12634342]
  • view in new tab

    Biological materials

    Mutant

  • GP747 (spc), GP726 (aphA3), GP810 (del tet), GP1157 (cat) all available in [SW|Jörg Stülke]'s lab
  • BKE37790 ([gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
  • BKK37790 ([gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
  • Expression vectors

  • expression of native ''rocG'' in ''B. subtilis'': pGP529 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab [Pubmed|18326565]
  • for purification of RocG from ''E. coli'' carrying an N-terminal Strep-tag: pGP902 (in [SW|pGP172]), a series of ''rocG'' variants is also available in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pWH844]: pGP860, available in [SW|Jörg Stülke]'s lab
  • purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP1709, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab [Pubmed|17183217]
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Fabian Commichau] Brandenburg Technical University Cottbus-Senftenberg, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]
  • References

    Reviews

  • 19698086,8299344,7705101,19895831,22625175,28615289
  • Enzymatic activity of RocG

  • 18603778,16244435,16195607,18326565,9829940,20630473,21965396,25711804,28468957
  • Function in the control of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] activity

  • 15150225,17994626,17608797,17183217,20630473,31649652
  • Expression of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]

  • 12634342,15150224,10468601,9829940,22900538,20817675,25777015,25880922,27766092
  • Structural analysis of glutamate dehydrogenase

  • 8263917,20630473
  • Bypass of [gene|search|rocG ]mutations

  • 21219666,22178973,23785476
  • Additional publications

  • 23338837,23419162,22178969,24473333,29242163