SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


iron/ citrate [SW|ABC transporter] (binding protein)
34.87 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
iron uptake
iron/ citrate [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    825,787 826,734

    Phenotypes of a mutant

  • poor growth with the Fe(III)-dicitrate as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1469148C83B1704E721652203EA31F0E2C33FDC6|YhfQ]
  • [SW|Domains]

  • [SW|Fe/B12 periplasmic-binding domain] (aa 60-315) (according to UniProt)
  • Structure

  • [PDB|3EIW] (from ''Staphylococcus aureus'', the [protein|569510093E5B69A0368205920A21A81CADF030E9|FecC]-[protein|1469148C83B1704E721652203EA31F0E2C33FDC6|YhfQ] complex, 46% identity) [Pubmed|19400778]
  • [SW|Localization]

  • associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]) [Pubmed|10092453,18763711]
  • extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
  • view in new tab


    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,16672620,12354229]
  • view in new tab



  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
  • view in new tab

    Biological materials


  • MGNA-C246 (yfmC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT, downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
  • BKK07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT, downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
  • References

  • 10092453,16672620,12354229,18957862,18763711,23220087,23199363,22383849,19400778,29133393