SubtiBank SubtiBank
fecC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fecC

iron/ citrate [SW|ABC transporter] (binding protein)
locus
BSU_07520
pI
7.88
mw
34.87 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
function
iron uptake
product
iron/ citrate [SW|ABC transporter] (binding protein)
essential
no
synonyms
yfmC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    825,787 826,734

    Phenotypes of a mutant

  • poor growth with the Fe(III)-dicitrate as single source of iron [Pubmed|23220087]
  • The protein

    Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1469148C83B1704E721652203EA31F0E2C33FDC6|YhfQ]
  • [SW|Domains]

  • [SW|Fe/B12 periplasmic-binding domain] (aa 60-315) (according to UniProt)
  • Structure

  • [PDB|3EIW] (from ''Staphylococcus aureus'', the [protein|569510093E5B69A0368205920A21A81CADF030E9|FecC]-[protein|1469148C83B1704E721652203EA31F0E2C33FDC6|YhfQ] complex, 46% identity) [Pubmed|19400778]
  • [SW|Localization]

  • associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]) [Pubmed|10092453,18763711]
  • extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
  • Expression and Regulation

    Operons

    genes
    [gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]-[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
  • view in new tab

    genes
    [gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
    description
    [Pubmed|16672620]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,16672620,12354229]
  • view in new tab

    genes
    [gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]
    description
    [Pubmed|22383849]

    regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C246 (yfmC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2244 NBRP B. subtilis, Japan]
  • BKE07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT, downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
  • BKK07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT, downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
  • References

  • 10092453,16672620,12354229,18957862,18763711,23220087,23199363,22383849,19400778,29133393