SubtiBank SubtiBank
ykjA [2018-10-10 18:30:47]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykjA [2018-10-10 18:30:47]

unknown
locus
BSU13060
pI
6.20
mw
27.56 kDa
protein length
243 aa Sequence Blast
gene length
729 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,374,437 → 1,375,168

    The protein

    Protein family

  • [SW|UPF0702 family] (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]-[gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]
    description
    [Pubmed|22383849]

    regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A745 (ykjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/745 NBRP B. subtilis, Japan]
  • BKE13060 (Δ[gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGATCTTTACCTCCATC, downstream forward: _UP4_TAAGATGGCTCTCTCTTGTA
  • BKK13060 (Δ[gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGATCTTTACCTCCATC, downstream forward: _UP4_TAAGATGGCTCTCTCTTGTA
  • References

  • 16479537,22383849