SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


27.56 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,374,437 1,375,168

    The protein

    Protein family

  • [SW|UPF0702 family] (according to UniProt)
  • Structure

  • [PDB|3C6F] ([protein|EBD0F966FD7B3662814D530064BD307561A5CB15|YetF], corresponds to aa 109 ... 224, 31% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation




  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • MGNA-A745 (ykjA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13060 ([gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGATCTTTACCTCCATC, downstream forward: _UP4_TAAGATGGCTCTCTCTTGTA
  • BKK13060 ([gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGATCTTTACCTCCATC, downstream forward: _UP4_TAAGATGGCTCTCTCTTGTA
  • References

  • 16479537,22383849