SubtiBank SubtiBank
pucI

pucI

allantoin permease
locus
BSU_36470
pI
7.88
mw
53.82 kDa
protein length
490 aa Sequence Blast
gene length
1473 bp Sequence Blast
function
purine utilization
product
allantoin permease
essential
no
synonyms
ywoE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,752,280 3,753,752

    The protein

    Catalyzed reaction/ biological activity

  • uptake of allantoin [Pubmed|26967546]
  • Protein family

  • purine-cytosine permease (2.A.39) family (with [protein|CB969A2D60F106466605052299F2A5FF5A20E9ED|YxlA], according to UniProt)
  • Structure

  • [PDB|2JLN] (from Microbacterium liquefaciens, 27% identity) [pubmed|18927357]
  • [SW|Localization]

  • cell membrane [Pubmed|26967546]
  • Expression and Regulation

    Operons

    genes
    [gene|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|pucI]
    description
    [Pubmed|12029039]

    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A897 (ywoE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/897 NBRP B. subtilis, Japan]
  • BKE36470 ([gene|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|pucI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCTCCCCTTTCC, downstream forward: _UP4_TAAGATCTATTTAGACGGTA
  • BKK36470 ([gene|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|pucI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCTCCCCTTTCC, downstream forward: _UP4_TAAGATCTATTTAGACGGTA
  • References

  • 11344136,12029039,12029039,26967546,27766092,18927357