SubtiBank SubtiBank
recN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recN

DNA repair and genetic recombination
locus
BSU_24240
pI
4.80
mw
64.31 kDa
protein length
576 aa Sequence Blast
gene length
1731 bp Sequence Blast
function
DNA repair and genetic recombination
product
DNA integrity scanning protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,520,557 2,522,287

    The protein

    Catalyzed reaction/ biological activity

  • RecN stimulates polymerizing activity of [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|PnpA] [Pubmed|21859751]
  • Protein family

  • recN family (single member, according to UniProt)
  • Structure

  • [PDB|4AD8] (from Deinococcus radiodurans, 30% identity) [pubmed|23085075]
  • [SW|Localization]

  • nucleoid (multiple) [Pubmed|16479537]
  • evenly distributed in growing cells [Pubmed|21859751]
  • upon DNA damage, RecN forms a single focus per nucleoid [Pubmed|21859751], recruitment is affected by the presence of [protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|fumarase] [pubmed|29140245]
  • Expression and Regulation

    Operons

    genes
    [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
    description
    [Pubmed|2106508]

    regulation

  • by [protein|search|sRNA] [protein|search|sr1]
  • additional information

  • expression is fourfold increased upon depletion of ''[SW|nusA]'' [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    genes
    [gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]-[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]-[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • 1A891 ( ''recN''::''cat''), [Pubmed|8510642], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A891&Search=1A891 BGSC]
  • BKE24240 ([gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACAGCATTACACCTCTT, downstream forward: _UP4_TAAGCTGCGCGAGAAGCGCA
  • BKK24240 ([gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACAGCATTACACCTCTT, downstream forward: _UP4_TAAGCTGCGCGAGAAGCGCA
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
  • References

    Reviews

  • 19308706,21517913,22933559,23380520
  • Original publications

  • 15849320,19060143,16385024,17999999,2106508,19730681,16479537,21859751,24373815,15186413,8510642,29140245,23085075,30192981,30401797