SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to SNF2 helicase
64.50 kDa
protein length
557 aa Sequence Blast
gene length
1674 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,549,775 2,551,448

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • SNF2/RAD54 helicase family (with [protein|265490FA83D6D3F178C26C9240E3CB224513BF42|YwqA], according to UniProt)
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 70-224) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 363-524) (according to UniProt)
  • Structure

  • [PDB|1Z6A] (from Sulfolobus solfataricus, 27% identity) [PDB|15882619]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • MGNA-C418 (yqhH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24580 ([gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTGAAACCGCCTT, downstream forward: _UP4_TAGCCTGTAAGGAGGTTTTA
  • BKK24580 ([gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTGAAACCGCCTT, downstream forward: _UP4_TAGCCTGTAAGGAGGTTTTA
  • References

  • 16497325,28189581,15882619