SubtiBank SubtiBank
yuaI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yuaI

unknown
locus
BSU_31000
pI
5.14
mw
19.70 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,179,926 3,180,447

    The protein

    Catalyzed reaction/ biological activity

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]-dependent expression of ''[gene|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|fabF]'' and the ''[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]'' operon result in reduced membrane fluidity [Pubmed|21542858,22178969]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 2-171) (according to UniProt)
  • Structure

  • [PDB|1WK4] (from Thermus thermophilus, 40% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed upon cell wall stress ([protein|search|SigW]) [Pubmed|9987136]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A221 (yuaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/221 NBRP B. subtilis, Japan]
  • BKE31000 ([gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACCATACGGTTCTGCCCTT, downstream forward: _UP4_TAACGAAAAATCCCCCAGCG
  • BKK31000 ([gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACCATACGGTTCTGCCCTT, downstream forward: _UP4_TAACGAAAAATCCCCCAGCG
  • References

  • 9987136