SubtiBank SubtiBank
yuzH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuzH

unknown
locus
BSU_31279
pI
9.00
mw
10.00 kDa
protein length
gene length
255 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,213,342 3,213,596

    Expression and Regulation

    Operons

    genes
    [gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]-[gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE31279 ([gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31279 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCACCTCAGTTT, downstream forward: _UP4_TCCGGAAAATAGGCGATGGG
  • BKK31279 ([gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31279 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCACCTCAGTTT, downstream forward: _UP4_TCCGGAAAATAGGCGATGGG
  • References

  • 26577401,27766092