SubtiBank SubtiBank
yopW
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yopW

unknown
locus
BSU_20740
pI
4.00
mw
12.41 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,202,381 2,202,716

    Biological materials

    Mutant

  • BKE20740 ([gene|560AEB7F072ACCF5C74FA34260ABA5E038CDFC12|yopW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATATCCCCCTCCAA, downstream forward: _UP4_ACGGATGAGGAGGATCCAGT
  • BKK20740 ([gene|560AEB7F072ACCF5C74FA34260ABA5E038CDFC12|yopW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATATCCCCCTCCAA, downstream forward: _UP4_ACGGATGAGGAGGATCCAGT