SubtiBank SubtiBank
xynC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xynC

endo-xylanase, preference for methylglucurono-xylan
locus
BSU_18150
pI
9.08
mw
47.17 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
xylan degradation
product
endo-xylanase
essential
no
ec
3.2.1.136
synonyms
ynfF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,942,714 1,943,982

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->4)-beta-D-xylosyl links in some glucuronoarabinoxylans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 30 family (single member, according to UniProt)
  • Structure

  • [PDB|3GTN] [Pubmed|19407387,21256135]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]-[gene|55D7F05F8592A53A58A032C78B847782E598B268|xynC]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B394 (ynfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1393 NBRP B. subtilis, Japan]
  • BKE18150 ([gene|55D7F05F8592A53A58A032C78B847782E598B268|xynC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTCCTCTCCTTCGT, downstream forward: _UP4_TAAGAGCACAAAGACACACA
  • BKK18150 ([gene|55D7F05F8592A53A58A032C78B847782E598B268|xynC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTCCTCTCCTTCGT, downstream forward: _UP4_TAAGAGCACAAAGACACACA
  • References

    Reviews

  • 20735481
  • Original publications

  • 19407387,18957862,17028274,20817675,21256135,24271172