SubtiBank SubtiBank
tetL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tetL

tetracycline resistance leader peptide
locus
BSU_40780
pI
10.24
mw
2.16 kDa
protein length
gene length
function
control of tetB expression
product
tetracycline resistance leader peptide
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Expression and Regulation

    Operons

    genes
    [gene|55C9FA5282B213915C164B46119C482D03491381|tetL]-[gene|4B900A64A96696F48BB0C2DC3B0884CD2F5E298B|tetB]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/tetLB.html DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2844262], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT, downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
  • BKK40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT, downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
  • References

  • 2844262