SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


tetracycline resistance leader peptide
2.16 kDa
protein length
gene length
control of tetB expression
tetracycline resistance leader peptide

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Expression and Regulation


    (according to [ DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2844262], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT, downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
  • BKK40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT, downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [ Homepage]
  • References

  • 2844262