SubtiBank SubtiBank
trmN6
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

trmN6

tRNA methyltransferase
locus
BSU_00340
pI
6.50
mw
28.13 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
tRNA modification
product
tRNA methyltransferase
essential
no
synonyms
yabB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    42,917 43,660

    The protein

    Structure

  • [PDB|3LPM] (putative methyltransferase from Listeria monocytogenes, 64% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    genes
    [gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B901 (yabB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1900 NBRP B. subtilis, Japan]
  • BKE00340 ([gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTATCCTTTCAGT, downstream forward: _UP4_ACAAAAGAAATCAGGACCAT
  • BKK00340 ([gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTATCCTTTCAGT, downstream forward: _UP4_ACAAAAGAAATCAGGACCAT
  • References

  • 22383849