SubtiBank SubtiBank
addB [2019-04-12 13:51:22]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

addB [2019-04-12 13:51:22]

ATP-dependent deoxyribonuclease (subunit B), required for efficient survival and replication restart after replication-transcription conflicts
134.41 kDa
protein length
1166 aa Sequence Blast
gene length
3501 bp Sequence Blast
DNA repair/ recombination
ATP-dependent deoxyribonuclease (subunit B))

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,136,320 1,139,820

    Phenotypes of a mutant

  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • The protein

    Catalyzed reaction/ biological activity

  • the enzyme is functional as a heterodimer of the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA] and [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB] subunits, that it is a rapid and processive DNA helicase, and that it catalyses DNA unwinding using one single-stranded DNA motor of 3'5' polarity located in the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA] subunit [Pubmed|21071401]
  • the [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB] subunit contains a second putative ATP-binding pocket, but this does not contribute to the observed helicase activity and may instead be involved in the recognition of recombination hotspot sequences [Pubmed|21071401]
  • Protein family

  • uvrD-like helicase C-terminal domain (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|3U4Q] (the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA]-[protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB]-DNA complex) [Pubmed|22307084]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials


  • GP1106 ([gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB], spc), available in [SW|Jörg Stülke]'s lab
  • BKE10620 ([gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTAGAAGACCCCTCTC, downstream forward: _UP4_TGGATAAAAAAGGAGGCGGA
  • BKK10620 ([gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTAGAAGACCCCTCTC, downstream forward: _UP4_TGGATAAAAAAGGAGGCGGA
  • labs

  • [SW|Mark Dillingham], Bristol, U.K. ([ homepage])
  • References


  • 23202527,20116346,22933559,19542287,25486468
  • Original publications

  • 21809208,8387145,15610857,7746142,19129187,1646786,10756102,9781875,17570399,20350930,22307084,22383849,21071401,23056615,24682829,24670664,8752329,25939832,26001966,8510642