SubtiBank SubtiBank
sunI
The papers of the month are back! Check them out! Link here

sunI

bacteriocin producer immunity protein
locus
BSU21490
pI
9.22
mw
12.12 kDa
protein length
105 aa Sequence Blast
gene length
315 bp Sequence Blast
function
immunity to sublancin
product
bacteriocin producer immunity protein
essential
no
synonyms
yolF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,269,988 → 2,270,305

    Phenotypes of a mutant

  • essential (facultative, ''[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'' can be deleted if ''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]'' is also absent) [Pubmed|19047653], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates immunity to sublancin [Pubmed|19047653]
  • Protein family

  • ribosomal protein S1P family (according to Swiss-Prot)
  • [SW|Localization]

  • membrane anchored protein [Pubmed|19047653] [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW| Jörg Stülke]'s lab
  • BKE21490 (Δ[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • BKK21490 (Δ[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • Labs working on this gene/protein

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

  • 18763711,19047653,22383849,28189581