SubtiBank SubtiBank
sunI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sunI

bacteriocin producer immunity protein
locus
BSU_21490
pI
9.22
mw
12.12 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
immunity to sublancin
product
bacteriocin producer immunity protein
essential
no
synonyms
yolF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,269,988 2,270,305

    Phenotypes of a mutant

  • essential (facultative, ''[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'' can be deleted if ''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]'' is also absent) [Pubmed|19047653], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates immunity to sublancin [Pubmed|19047653]
  • [SW|Localization]

  • membrane anchored protein [Pubmed|19047653] [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]
    description
    [Pubmed|22383849]

    additional information:

  • the expression is homogeneous in the population [pubmed|30808982]
  • view in new tab

    Biological materials

    Mutant

  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • BKK21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

  • 18763711,19047653,22383849,28189581,30808982