SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


27.90 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,466,638 1,467,411

    The protein


  • SCP domain (aa 141-254) (according to UniProt)
  • Structure

  • [PDB|4IFA] (from B. anthracis, C-terminal SCP domain of YkwD, aa 138 ... 257, 40% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B334 (ykwD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA, downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
  • BKK13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA, downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
  • References

  • 20525796