SubtiBank SubtiBank
ykwD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykwD

unknown
locus
BSU_13970
pI
10.11
mw
27.90 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,466,638 1,467,411

    The protein

    [SW|Domains]

  • SCP domain (aa 141-254) (according to UniProt)
  • Structure

  • [PDB|4IFA] (from B. anthracis, C-terminal SCP domain of YkwD, aa 138 ... 257, 40% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B334 (ykwD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1333 NBRP B. subtilis, Japan]
  • BKE13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA, downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
  • BKK13970 ([gene|55674E91861B43885F93A754B34886BB428DC60B|ykwD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCGTAACCTCCTA, downstream forward: _UP4_TAATAAAAAAAGATTGCCTG
  • References

  • 20525796