SubtiBank SubtiBank
yozD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozD

unknown
locus
BSU_19660
pI
3.60
mw
6.88 kDa
protein length
gene length
177 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,137,602 2,137,778

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|A8D37295A5E6857A978998211211AEA0204AB029|yodN]-[gene|555AA24C58041AA593C551DBA72EDB943E6D4CA8|yozD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE19660 ([gene|555AA24C58041AA593C551DBA72EDB943E6D4CA8|yozD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCGTACCGCCTCCTT, downstream forward: _UP4_TGAGGCTTAAAACCGGAGCG
  • BKK19660 ([gene|555AA24C58041AA593C551DBA72EDB943E6D4CA8|yozD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCGTACCGCCTCCTT, downstream forward: _UP4_TGAGGCTTAAAACCGGAGCG
  • References

  • 16479537