SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


6.88 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    2,137,602 2,137,778

    The protein


  • cell membrane (according to Swiss-Prot)
  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE19660 ([gene|555AA24C58041AA593C551DBA72EDB943E6D4CA8|yozD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCGTACCGCCTCCTT, downstream forward: _UP4_TGAGGCTTAAAACCGGAGCG
  • BKK19660 ([gene|555AA24C58041AA593C551DBA72EDB943E6D4CA8|yozD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCGTACCGCCTCCTT, downstream forward: _UP4_TGAGGCTTAAAACCGGAGCG
  • References

  • 16479537