SubtiBank SubtiBank
yxjH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxjH

putative methionine synthase
locus
BSU38950
pI
5.09
mw
38.14 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
unknown
product
putative methionine synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.11|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    Coordinates
    3,997,964 3,999,097

    The protein

    Paralogous protein(s)

  • [protein|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|YxjG]
  • Structure

  • [PDB|1YPX] (the enzyme from ''Listeria monocytogenes'', 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([[SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B732 (yxjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1731 NBRP B. subtilis, Japan]
  • BKE38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC, downstream forward: _UP4_TAATCTATCATTGACAGAAA
  • BKK38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC, downstream forward: _UP4_TAATCTATCATTGACAGAAA
  • References

  • 19258532,10094622,18039762,12107147