SubtiBank SubtiBank
yxjH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxjH

putative methionine synthase
locus
BSU_38950
pI
5.09
mw
38.14 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
unknown
product
putative methionine synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.11|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    Coordinates
    3,997,964 3,999,097

    The protein

    Paralogous protein(s)

  • [protein|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|YxjG]
  • Structure

  • [PDB|1YPX] (the enzyme from ''Listeria monocytogenes'', 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([[SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B732 (yxjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1731 NBRP B. subtilis, Japan]
  • BKE38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC, downstream forward: _UP4_TAATCTATCATTGACAGAAA
  • BKK38950 ([gene|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCGCCTCTTTTC, downstream forward: _UP4_TAATCTATCATTGACAGAAA
  • References

  • 19258532,10094622,18039762,12107147