SubtiBank SubtiBank
fpbN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fpbN

petrobactin (3.4-catecholate siderophore) [SW|ABC transporter] (permease)
locus
BSU_03800
pI
9.82
mw
34.75 kDa
protein length
316 aa Sequence Blast
gene length
951 bp Sequence Blast
function
acquisition of iron
product
petrobactin [SW|ABC transporter] (permease)
essential
no
synonyms
yclN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    432,372 433,322

    The protein

    Catalyzed reaction/ biological activity

  • uptake of the siderophore petrobactin [Pubmed|19955416]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|FecCD subfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]-[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]-[gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]-[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]
    description
    [Pubmed|19955416]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C010 (yclN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2008 NBRP B. subtilis, Japan]
  • BKE03800 ([gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCCTCCTTACATCC, downstream forward: _UP4_TTTATGCTGTTAAGGAGAAA
  • BKK03800 ([gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCCTCCTTACATCC, downstream forward: _UP4_TTTATGCTGTTAAGGAGAAA
  • References

  • 10092453,19955416,12354229,29133393