SubtiBank SubtiBank


glyoxalase I
14.29 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
detoxification of methylglyoxal
glyoxalase I

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,937,135 3,937,515

    Phenotypes of a mutant

  • increased sensitivity to methylglyoxal [Pubmed|24330391]
  • The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal + BSH - S-lactoyl-bacillithiol (BSH) [Pubmed|24330391]
  • Protein family

  • glyoxalase I family (with [protein|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|YraH] and [protein|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|GlxB], according to UniProt)
  • [SW|Domains]

  • [SW|VOC domain] (aa 4-126) (according to UniProt)
  • Structure

  • [PDB|1F9Z] (from E. coli, 35% identity) [pubmed|10913283]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B221 (ywbC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA, downstream forward: _UP4_TAAAAATAAAGAACGTACAT
  • BKK38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA, downstream forward: _UP4_TAAAAATAAAGAACGTACAT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 9353933,24330391,10913283