SubtiBank SubtiBank
yjbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjbC

general stress protein, required for survival of salt and paraquat stresses
locus
BSU11490
pI
5.14
mw
22.96 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
survival of paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,226,938 1,227,516

    Phenotypes of a mutant

  • strongly impaired survival of salt stress [Pubmed|15805528]
  • Expression and Regulation

    Operons

    genes
    [gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]-[gene|2C6386E9A63F410558D168798D077DF91590F454|spx]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [PubMed|10913081], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|17158660], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B150 (yjbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1149 NBRP B. subtilis, Japan]
  • BKE11490 ([gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTGCTCCTTATGA, downstream forward: _UP4_TAATTGAGAATAAGAACATA
  • BKK11490 ([gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTGCTCCTTATGA, downstream forward: _UP4_TAATTGAGAATAAGAACATA
  • References

  • 10913081,22582280,17158660,15805528,17158660,15805528,21815947