SubtiBank SubtiBank
yobW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobW

sporulation membrane protein
locus
BSU_19110
pI
10.16
mw
21.15 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
csk22

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,084,214 2,084,759

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|54BED3A1A405A63B82D16CEAAD1B5E505937C336|yobW]
    description
    [Pubmed|8990290]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|8990290], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK])[Pubmed|15699190,8990290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A059 (yobW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/59 NBRP B. subtilis, Japan]
  • BKE19110 ([gene|54BED3A1A405A63B82D16CEAAD1B5E505937C336|yobW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGAAATCCCCTCC, downstream forward: _UP4_TAACAGCGAGTTAAGCAAGG
  • BKK19110 ([gene|54BED3A1A405A63B82D16CEAAD1B5E505937C336|yobW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGAAATCCCCTCC, downstream forward: _UP4_TAACAGCGAGTTAAGCAAGG
  • References

  • 15699190,8990290