SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation membrane protein
21.15 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,084,214 2,084,759

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|8990290], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK])[Pubmed|15699190,8990290]
  • view in new tab

    Biological materials


  • MGNA-A059 (yobW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19110 ([gene|54BED3A1A405A63B82D16CEAAD1B5E505937C336|yobW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGAAATCCCCTCC, downstream forward: _UP4_TAACAGCGAGTTAAGCAAGG
  • BKK19110 ([gene|54BED3A1A405A63B82D16CEAAD1B5E505937C336|yobW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGAAATCCCCTCC, downstream forward: _UP4_TAACAGCGAGTTAAGCAAGG
  • References

  • 15699190,8990290