SubtiBank SubtiBank
yonB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonB

unknown
locus
BSU_21150
pI
7.18
mw
37.04 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,236,269 2,237,285

    Biological materials

    Mutant

  • BKE21150 ([gene|54B65658D2BD0323CF01AC980553B9E48F589211|yonB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAATACTCCTTTTA, downstream forward: _UP4_TAAATCAAAATATGAGGATT
  • BKK21150 ([gene|54B65658D2BD0323CF01AC980553B9E48F589211|yonB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAATACTCCTTTTA, downstream forward: _UP4_TAAATCAAAATATGAGGATT
  • References

  • 27766092